» Authors » Ahmad Al-Attar

Ahmad Al-Attar

Explore the profile of Ahmad Al-Attar including associated specialties, affiliations and a list of published articles. Areas
Snapshot
Articles 39
Citations 762
Followers 0
Related Specialties
Top 10 Co-Authors
Published In
Affiliations
Soon will be listed here.
Recent Articles
11.
Zhong Y, Mohan K, Liu J, Al-Attar A, Lin P, Flight R, et al.
Biochim Biophys Acta Mol Basis Dis . 2020 Jun; 1866(10):165883. PMID: 32592935
Juvenile neuronal ceroid lipofuscinosis (JNCL, aka. juvenile Batten disease or CLN3 disease) is a lysosomal storage disease characterized by progressive blindness, seizures, cognitive and motor failures, and premature death. JNCL...
12.
Gonzalez O, Euzebio-Alves V, Alimova Y, Al-Attar A, Ebersole J
Adv Exp Med Biol . 2019 Nov; 1197:79-95. PMID: 31732936
Porphyromonas gingivalis is an oral pathogen with the ability to induce oral dysbiosis and periodontal disease. Nevertheless, the mechanisms by which P. gingivalis could abrogate the host-microbe symbiotic relationship leading...
13.
Reed R, Presnell S, Al-Attar A, Lutz C, Segerstrom S
Brain Behav Immun . 2019 Mar; 80:266-274. PMID: 30885843
Cytomegalovirus (CMV) and psychological stress are implicated as drivers of immunological aging. It is unknown, however, whether associations among CMV titers, stress, and immune aging are more stable or dynamic...
14.
Reed R, Al-Attar A, Presnell S, Lutz C, Segerstrom S
Exp Gerontol . 2019 Mar; 121:46-54. PMID: 30885717
The stability and variability of older adults' late-differentiated peripheral blood T and natural killer (NK) cells over time remains incompletely quantified or understood. We examined the variability and change over...
15.
Al-Attar A, Alimova Y, Kirakodu S, Kozal A, Novak M, Stromberg A, et al.
Mucosal Immunol . 2019 Feb; 12(4):1066. PMID: 30796336
The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.
16.
Gedaly R, De Stefano F, Turcios L, Hill M, Hidalgo G, Mitov M, et al.
Transplantation . 2018 Nov; 103(4):705-715. PMID: 30451741
Background: Experimental and preclinical evidence suggest that adoptive transfer of regulatory T (Treg) cells could be an appropriate therapeutic strategy to induce tolerance and improve graft survival in transplanted patients....
17.
Ferrin J, Kirakodu S, Jensen D, Al-Attar A, Peyyala R, Novak M, et al.
J Periodontol . 2018 Apr; 89(7):858-866. PMID: 29676776
Background: Neuropeptides (NPs) are innate pivotal regulators of the immunoinflammatory response. Nevertheless, their role in the pathogenesis of periodontal disease remains unknown. Changes in gene expression of 10 NPs and...
18.
Al-Attar A, Presnell S, Clasey J, Long D, Walton R, Sexton M, et al.
Front Immunol . 2018 Mar; 9:440. PMID: 29559978
Natural killer (NK) lymphocyte-mediated cytotoxicity and cytokine secretion control infections and cancers, but these crucial activities decline with age. NK cell development, homeostasis, and function require IL-15 and its chaperone,...
19.
Al-Attar A, Alimova Y, Kirakodu S, Kozal A, Novak M, Stromberg A, et al.
Mucosal Immunol . 2018 Mar; 11(4):1047-1059. PMID: 29515164
P. gingivalis (Pg) is an oral pathogen with the ability to induce oral dysbiosis and periodontal disease. Nevertheless, the mechanisms by which mucosal responses to the oral microbiota in the...
20.
Ebersole J, Dawson 3rd D, Emecen-Huja P, Nagarajan R, Howard K, Grady M, et al.
Periodontol 2000 . 2017 Aug; 75(1):52-115. PMID: 28758303
Maintenance of periodontal health or transition to a periodontal lesion reflects the continuous and ongoing battle between the vast microbial ecology in the oral cavity and the array of resident...