» Authors » Julian Huppert

Julian Huppert

Explore the profile of Julian Huppert including associated specialties, affiliations and a list of published articles. Areas
Snapshot
Articles 6
Citations 3270
Followers 0
Related Specialties
Top 10 Co-Authors
Published In
Affiliations
Soon will be listed here.
Recent Articles
1.
Liddell K, Ruck Keene A, Holland A, Huppert J, Underwood B, Clark O, et al.
Int J Law Psychiatry . 2021 Jan; 74:101649. PMID: 33418151
This article investigates the lawfulness of isolating residents of care and group homes during the COVID-19 pandemic. Many residents are mobile, and their freedom to move is a central ethical...
2.
Lister A, Charoensawan V, De S, James K, Janga S, Huppert J
Genome Biol . 2009 Jul; 10(6):309. PMID: 19591648
A report of BioSysBio 2009, the IET conference on Synthetic Biology, Systems Biology and Bioinformatics, Cambridge, UK, 23-25 March 2009.
3.
Birney E, Stamatoyannopoulos J, Dutta A, Guigo R, Gingeras T, Margulies E, et al.
Nature . 2007 Jun; 447(7146):799-816. PMID: 17571346
We report the generation and analysis of functional data from multiple, diverse experiments performed on a targeted 1% of the human genome as part of the pilot phase of the...
4.
Fernando H, Reszka A, Huppert J, Ladame S, Rankin S, Venkitaraman A, et al.
Biochemistry . 2006 Jun; 45(25):7854-60. PMID: 16784237
The c-kit gene encodes a receptor tyrosine kinase, whose engagement by its ligand triggers signals leading to cell proliferation. c-kit activity is elevated in gastrointestinal stromal tumors (GISTs), and its...
5.
Rankin S, Reszka A, Huppert J, Zloh M, Parkinson G, Todd A, et al.
J Am Chem Soc . 2005 Jul; 127(30):10584-9. PMID: 16045346
The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence...
6.
Hazel P, Huppert J, Balasubramanian S, Neidle S
J Am Chem Soc . 2004 Dec; 126(50):16405-15. PMID: 15600342
Guanine-rich DNA sequences can form a large number of structurally diverse quadruplexes. These vary in terms of strand polarity, loop composition, and conformation. We have derived guidelines for understanding the...