The Nucleotide Sequence of 5S RRNA from Mycoplasma Capricolum

Overview

Journal Nucleic Acids Res

Publisher Oxford University Press

Specialty Biochemistry

Date 1981 Oct 24

PMID 7301591

Citations 21

Authors

H Hori

M Sawada

S Osawa

K Murao

H Ishikura

Affiliations

Soon will be listed here.

Abstract

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

Citing Articles

RNase P RNA of Mycoplasma capricolum.

Ushida C, Izawa D, Muto A Mol Biol Rep. 1995; 22(2-3):125-9.

PMID: 8901498 DOI: 10.1007/BF00988716.

A small RNA of Mycoplasma capricolum that resembles eukaryotic U6 small nuclear RNA.

Ushida C, Muto A Nucleic Acids Res. 1993; 21(11):2649-53.

PMID: 7687343 PMC: 309594. DOI: 10.1093/nar/21.11.2649.

Generalized structures of the 5S ribosomal RNAs.

Delihas N, Andersen J Nucleic Acids Res. 1982; 10(22):7323-44.

PMID: 7155895 PMC: 327007. DOI: 10.1093/nar/10.22.7323.

The protein composition of Mycoplasma capricolum.

Kawauchi Y, Muto A, Osawa S Mol Gen Genet. 1982; 188(1):7-11.

PMID: 6960228 DOI: 10.1007/BF00332989.

Collection of published 5S and 5.8S ribosomal RNA sequences.

Erdmann V, Huysmans E, Vandenberghe A, De Wachter R Nucleic Acids Res. 1983; 11(1):r105-33.

PMID: 6866760 PMC: 325704.

References

Brownlee G, SANGER F, Barrell B . Nucleotide sequence of 5S-ribosomal RNA from Escherichia coli. Nature. 1967; 215(5102):735-6. DOI: 10.1038/215735a0. View

Jones A, Walker R . Isolation and analysis of the deoxyribonucleic acid of Mycoplasma mycoides var. Capri. Nature. 1963; 198:588-9. DOI: 10.1038/198588a0. View

Wallace D, Morowitz H . Genome size and evolution. Chromosoma. 1973; 40(2):121-6. DOI: 10.1007/BF00321457. View

Maniloff J, Morowitz H . Cell biology of the mycoplasmas. Bacteriol Rev. 1972; 36(3):263-90. PMC: 378448. DOI: 10.1128/br.36.3.263-290.1972. View

Razin S . Physiology of mycoplasmas. Adv Microb Physiol. 1973; 10:1-80. DOI: 10.1016/s0065-2911(08)60086-7. View

Tully J, Barile M, Edward D, THEODORE T, Erno H . Characterization of some caprine mycoplasmas, with proposals for new species, mycoplasma capricolum and mycoplasma putrefaciens. J Gen Microbiol. 1974; 85(1):102-20. DOI: 10.1099/00221287-85-1-102. View

Herr W, Noller H . A fragment of 23S RNA containing a nucleotide sequence complementary to a region of 5S RNA. FEBS Lett. 1975; 53(2):248-52. DOI: 10.1016/0014-5793(75)80030-5. View

Marotta C, Varricchio F, Smith I, Weissman S . The primary structure of Bacillus subtilis and Bacillus stearothermophilus 5 S ribonucleic acids. J Biol Chem. 1976; 251(10):3122-7. View

Chang S, Brum C, Siberklang M, RajBhandary U, Hecker L, Barnett W . The first nucleotide sequence of an organelle transfer RNA: chloroplastic tRNAphe. Cell. 1976; 9(4 PT 2):717-23. DOI: 10.1016/0092-8674(76)90135-5. View

10.

Silberklang M, Prochiantz A, Haenni A, RajBhandary U . Studies on the sequence of the 3'-terminal region of turnip-yellow-mosaic-virus RNA. Eur J Biochem. 1977; 72(3):465-78. DOI: 10.1111/j.1432-1033.1977.tb11270.x. View

11.

Walker R, RajBhandary U . The nucleotide sequence of formylmethionine tRNA from Mycoplasma mycoides sp. capri. Nucleic Acids Res. 1978; 5(1):57-70. PMC: 341961. DOI: 10.1093/nar/5.1.57. View

12.

Stanley J, VASSILENKO S . A different approach to RNA sequencing. Nature. 1978; 274(5666):87-9. DOI: 10.1038/274087a0. View

13.

Hori H, Osawa S . Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species. Proc Natl Acad Sci U S A. 1979; 76(1):381-5. PMC: 382943. DOI: 10.1073/pnas.76.1.381. View

14.

Peattie D . Direct chemical method for sequencing RNA. Proc Natl Acad Sci U S A. 1979; 76(4):1760-4. PMC: 383470. DOI: 10.1073/pnas.76.4.1760. View

15.

Kuchino Y, Kato M, Sugisaki H, Nishimura S . Nucleotide sequence of starfish initiator tRNA. Nucleic Acids Res. 1979; 6(11):3459-69. PMC: 327948. DOI: 10.1093/nar/6.11.3459. View

16.

Kilpatrick M, Walker R . The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri. Nucleic Acids Res. 1980; 8(12):2783-6. PMC: 324120. DOI: 10.1093/nar/8.12.2783. View

17.

Hori H, Osawa S, Murao K, Ishikura H . The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus. Nucleic Acids Res. 1980; 8(22):5423-6. PMC: 324311. DOI: 10.1093/nar/8.22.5423. View

18.

Johnson J, Horowitz J . Characterization of ribosomes and RNAs from Mycoplasma hominis. Biochim Biophys Acta. 1971; 247(2):262-79. DOI: 10.1016/0005-2787(71)90675-7. View