Reverse Transcription Loop-mediated Isothermal Amplification (RT-LAMP) Primer Design Based on Indonesia SARS-CoV-2 RNA Sequence

Overview

Journal J Genet Eng Biotechnol

Specialty Biotechnology

Date 2023 Dec 18

PMID 38109021

Authors

Irsyad Ibadurrahman

Suryani

Desriani

Affiliations

Soon will be listed here.

Abstract

Background: The COVID-19 pandemic has highlighted the importance of tracking cases by using various methods such as the Reverse transcription loop-mediated isothermal amplification (RT-LAMP) which is a fast, simple, inexpensive, and accurate mass tracker. However, there have been no reports about the development of RT-LAMP primer designs that use genome sequences of viruses from Indonesia. Therefore, this study aimed to design an RT-LAMP primer using SARS-CoV-2 genome sequences from Indonesia and several other countries representing five continents in the world, as well as genomes from five Variants of Concern (VOC).

Result: The results showed that the consensus sequence of 70 SARS-CoV-2 virus sequences was obtained with a length of 29,982 bases. The phylogenetic test confirmed that the consensus sequence had a close kinship with the SARS-CoV-2 Wuhan Isolate. Furthermore, the SimPlot analysis showed that there was a high genetic diversity of sequences from the Coronaviridae tribal virus at base sequences of 1,500-5,000, 6,500-7,500, and 23,300-25,500. A total of 139 sets of primers were obtained from the primer design with 4 sets namely T1_6, T1_9, T4_7, and T4_52 having the best characteristics. Based on the secondary structure analysis test on 4 sets of primers, T1_6 and T1_9 were predicted not to form secondary structures at RT-LAMP operational temperatures. The primer set T1_9 showed better specificity in BLAST NCBI and eLAMP BLAST tests.

Conclusion: This study obtained a primer set of T1_9 with base sequence F3: CACTGAGACTCATTGATGCTATG, B3: CCAACCGTCTCTAAGAAACTCT, F2: GTTCACATCTGATTTGGCTACT, F1c: GAAGTCAACTGAACAACACCACCT, B2: CCTTCCTTAAACTTCTCTTCAAGC, B1c: GTGGCTAACTAACATCTTTGGCACT, LB: TGAAAACAAACCCGCCGTCCTTG, which meets the ideal parameters and has the best specificity. Therefore, it is recommended for use in further tests to recognize SARS-CoV-2 from Indonesia, other five continents, as well as five VOCs, including the new Omicron sub-variant.

References

Khan P, Aufdembrink L, Engelhart A . Isothermal SARS-CoV-2 Diagnostics: Tools for Enabling Distributed Pandemic Testing as a Means of Supporting Safe Reopenings. ACS Synth Biol. 2020; 9(11):2861-2880. DOI: 10.1021/acssynbio.0c00359. View

Tsimpidis M, Bachoumis G, Mimouli K, Kyriakopoulou Z, Robertson D, Markoulatos P . T-RECs: rapid and large-scale detection of recombination events among different evolutionary lineages of viral genomes. BMC Bioinformatics. 2017; 18(1):13. PMC: 5216575. DOI: 10.1186/s12859-016-1420-z. View

Soroka M, Wasowicz B, Rymaszewska A . Loop-Mediated Isothermal Amplification (LAMP): The Better Sibling of PCR?. Cells. 2021; 10(8). PMC: 8393631. DOI: 10.3390/cells10081931. View

Ghosh R, Tarafdar A, Sharma M . Rapid and sensitive diagnoses of dry root rot pathogen of chickpea (Rhizoctonia bataticola (Taub.) Butler) using loop-mediated isothermal amplification assay. Sci Rep. 2017; 7:42737. PMC: 5316965. DOI: 10.1038/srep42737. View

Dong Y, Wu X, Li S, Lu R, Li Y, Wan Z . Comparative evaluation of 19 reverse transcription loop-mediated isothermal amplification assays for detection of SARS-CoV-2. Sci Rep. 2021; 11(1):2936. PMC: 7858603. DOI: 10.1038/s41598-020-80314-0. View

Patel J, Sarma B . Designing and experimental evaluation of gene-specific primers of pea () defense proteins. 3 Biotech. 2018; 8(11):482. PMC: 6234199. DOI: 10.1007/s13205-018-1508-4. View

Lole K, Bollinger R, Paranjape R, Gadkari D, Kulkarni S, Novak N . Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination. J Virol. 1998; 73(1):152-60. PMC: 103818. DOI: 10.1128/JVI.73.1.152-160.1999. View

Kumar A, Kaur J . Primer Based Approach for PCR Amplification of High GC Content Gene: Mycobacterium Gene as a Model. Mol Biol Int. 2014; 2014:937308. PMC: 3982478. DOI: 10.1155/2014/937308. View

Mathews D . Using an RNA secondary structure partition function to determine confidence in base pairs predicted by free energy minimization. RNA. 2004; 10(8):1178-90. PMC: 1370608. DOI: 10.1261/rna.7650904. View

10.

Huang X, Tang G, Ismail N, Wang X . Developing RT-LAMP assays for rapid diagnosis of SARS-CoV-2 in saliva. EBioMedicine. 2021; 75:103736. PMC: 8674011. DOI: 10.1016/j.ebiom.2021.103736. View

11.

Edgar R . MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics. 2004; 5:113. PMC: 517706. DOI: 10.1186/1471-2105-5-113. View

12.

Li Y, Lu Y . BLASTP-ACC: Parallel Architecture and Hardware Accelerator Design for BLAST-Based Protein Sequence Alignment. IEEE Trans Biomed Circuits Syst. 2019; 13(6):1771-1782. DOI: 10.1109/TBCAS.2019.2943539. View

13.

Owoicho O, Olwal C, Tettevi E, Atu B, Durugbo E . Loop-mediated isothermal amplification for pecies surveillance in under-resourced setting: a review of evidence. Expert Rev Mol Diagn. 2022; 22(6):643-653. DOI: 10.1080/14737159.2022.2109963. View

14.

Park G, Ku K, Baek S, Kim S, Kim S, Kim B . Development of Reverse Transcription Loop-Mediated Isothermal Amplification Assays Targeting Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2). J Mol Diagn. 2020; 22(6):729-735. PMC: 7144851. DOI: 10.1016/j.jmoldx.2020.03.006. View

15.

Zhang Y, Tanner N . Improving RT-LAMP detection of SARS-CoV-2 RNA through primer set selection and combination. PLoS One. 2022; 17(4):e0254324. PMC: 8974972. DOI: 10.1371/journal.pone.0254324. View

16.

Sternke M, Tripp K, Barrick D . The use of consensus sequence information to engineer stability and activity in proteins. Methods Enzymol. 2020; 643:149-179. PMC: 8098710. DOI: 10.1016/bs.mie.2020.06.001. View

17.

Zhou Y, Wan Z, Yang S, Li Y, Li M, Wang B . A Mismatch-Tolerant Reverse Transcription Loop-Mediated Isothermal Amplification Method and Its Application on Simultaneous Detection of All Four Serotype of Dengue Viruses. Front Microbiol. 2019; 10:1056. PMC: 6518337. DOI: 10.3389/fmicb.2019.01056. View

18.

Ocenar J, Arizala D, Boluk G, Dhakal U, Gunarathne S, Paudel S . Development of a robust, field-deployable loop-mediated isothermal amplification (LAMP) assay for specific detection of potato pathogen Dickeya dianthicola targeting a unique genomic region. PLoS One. 2019; 14(6):e0218868. PMC: 6590888. DOI: 10.1371/journal.pone.0218868. View

19.

Li X, Giorgi E, Marichannegowda M, Foley B, Xiao C, Kong X . Emergence of SARS-CoV-2 through recombination and strong purifying selection. Sci Adv. 2020; 6(27). PMC: 7458444. DOI: 10.1126/sciadv.abb9153. View

20.

Salinas N, Little D . Electric LAMP: Virtual Loop-Mediated Isothermal AMPlification. ISRN Bioinform. 2015; 2012:696758. PMC: 4417551. DOI: 10.5402/2012/696758. View