N.m.r. Assignments and Temperature-dependent Conformational Transitions of a Mutant Trp Operator-promoter in Solution

Overview

Journal Biochem J

Specialty Biochemistry

Date 1989 May 1

PMID 2730583

Citations 6

Authors

A N Lane

Affiliations

Soon will be listed here.

Abstract

A total of 145 protons in the mutant trp operator-promoter sequence CGTACTGATTAATCAGTACG were assigned by one-dimensional and two-dimensional n.m.r. methods. Except at the sites of mutation (underlined), the chemical shifts and other n.m.r. parameters are very similar to those observed in the symmetrized wild-type sequence [Lefèvre, Lane & Jardetzky (1987) Biochemistry 26, 5076-5090]. Spin-spin-relaxation rate constants of the resolved base protons and intra- and inter-nucleotide nuclear-Overhauser-enhancement intensities argue for a sequence-dependent structure similar to that of the wild-type, except at and close to the sites of the mutation. The overall tumbling time as a function of temperature was determined from cross-relaxation rate constants for the H-6-H-5 vectors of the four cytosine residues. The values are consistent with the oligonucleotide maintaining a double-helical conformation over the entire temperature range 5-45 degrees C, and that internal motions of the bases are of small amplitude on the subnanosecond time scale. The temperature-dependence of chemical shifts, spin-spin-relaxation rate constants and cross-relaxation rate constants show the occurrence of two conformational transitions localized to the TTAA sequence in the centre of the molecule. The thermodynamics of the transition at the lower temperature (tm = 16 degrees C) were analysed according to a two-state process. The mid-point temperature is about 6 degrees C higher than in the wild-type sequence. The conformational transition does not lead to rupture of the Watson-Crick hydrogen bonds, but probably involves changes in the propellor twists of T.A-9 and T.A-10. The second transition occurs at about 40 degrees C, but cannot be fully characterized. This conformational variability seems to be a property of the sequence TTAA, and may have functional significance in bacterial promoters.

Citing Articles

High-resolution NMR structure of an AT-rich DNA sequence.

Ulyanov N, Bauer W, James T J Biomol NMR. 2002; 22(3):265-80.

PMID: 11991355 DOI: 10.1023/a:1014987532546.

Determination of conformational transition rates in the trp promoter by 1H NMR rotating-frame T1 and cross-relaxation rate measurements.

Lane A, Bauer C, Frenkiel T Eur Biophys J. 1993; 21(6):425-31.

PMID: 8449175 DOI: 10.1007/BF00185870.

Conformational properties of the -35 region of the trp promoter in solution: comparison of the wild-type sequence with an AT transversion.

Lane A, Bauer C, Frenkiel T, Birchall A Eur Biophys J. 1993; 22(2):135-43.

PMID: 8359145 DOI: 10.1007/BF00196917.

The effects of sequence context on base dynamics at TpA steps in DNA studied by NMR.

McAteer K, Ellis P, Kennedy M Nucleic Acids Res. 1995; 23(19):3962-6.

PMID: 7479043 PMC: 307317. DOI: 10.1093/nar/23.19.3962.

Anisotropic rotation in nucleic acid fragments: significance for determination of structures from NMR data.

Birchall A, Lane A Eur Biophys J. 1990; 19(2):73-8.

PMID: 2073892 DOI: 10.1007/BF00185089.

References

Patel D, Hilbers C . Proton nuclear magnetic resonance investigations of fraying in double-stranded d-ApTpGpCpApT in H2O solution. Biochemistry. 1975; 14(12):2651-6. DOI: 10.1021/bi00683a014. View

van de Ven F, Hilbers C . Resonance assignments of non-exchangeable protons in B type DNA oligomers, an overview. Nucleic Acids Res. 1988; 16(13):5713-26. PMC: 336824. DOI: 10.1093/nar/16.13.5713. View

Arter D, SCHMIDT P . Ring current shielding effects in nucleic acid double helices. Nucleic Acids Res. 1976; 3(6):1437-47. PMC: 343003. DOI: 10.1093/nar/3.6.1437. View

Bennett G, Yanofsky C . Sequence analysis of operator constitutive mutants of the tryptophan operon of Escherichia coli. J Mol Biol. 1978; 121(2):179-92. DOI: 10.1016/s0022-2836(78)80004-7. View

Oppenheim D, Bennett G, Yanofsky C . Escherichia coli RNA polymerase and trp repressor interaction with the promoter-operator region of the tryptophan operon of Salmonella typhimurium. J Mol Biol. 1980; 144(2):133-42. DOI: 10.1016/0022-2836(80)90029-7. View

Early T, Kearns D, Hillen W, Wells R . A 300- and 600-MHz proton nuclear magnetic resonance investigation of a 12 base pair deoxyribonucleic acid restriction fragment: relaxation behavior of the low-field resonances in water. Biochemistry. 1981; 20(13):3756-64. DOI: 10.1021/bi00516a014. View

Fratini A, Kopka M, Drew H, DICKERSON R . Reversible bending and helix geometry in a B-DNA dodecamer: CGCGAATTBrCGCG. J Biol Chem. 1982; 257(24):14686-707. View

Calladine C . Mechanics of sequence-dependent stacking of bases in B-DNA. J Mol Biol. 1982; 161(2):343-52. DOI: 10.1016/0022-2836(82)90157-7. View

Patel D, Ikuta S, Kozlowski S, Itakura K . Sequence dependence of hydrogen exchange kinetics in DNA duplexes at the individual base pair level in solution. Proc Natl Acad Sci U S A. 1983; 80(8):2184-8. PMC: 393782. DOI: 10.1073/pnas.80.8.2184. View

10.

DICKERSON R . Base sequence and helix structure variation in B and A DNA. J Mol Biol. 1983; 166(3):419-41. DOI: 10.1016/s0022-2836(83)80093-x. View

11.

Patel D, Kozlowski S, Bhatt R . Sequence dependence of base-pair stacking in right-handed DNA in solution: proton nuclear Overhauser effect NMR measurements. Proc Natl Acad Sci U S A. 1983; 80(13):3908-12. PMC: 394168. DOI: 10.1073/pnas.80.13.3908. View

12.

Hare D, Wemmer D, Chou S, Drobny G, Reid B . Assignment of the non-exchangeable proton resonances of d(C-G-C-G-A-A-T-T-C-G-C-G) using two-dimensional nuclear magnetic resonance methods. J Mol Biol. 1983; 171(3):319-36. DOI: 10.1016/0022-2836(83)90096-7. View

13.

Weiss M, Patel D, Sauer R, Karplus M . Two-dimensional 1H NMR study of the lambda operator site OL1: a sequential assignment strategy and its application. Proc Natl Acad Sci U S A. 1984; 81(1):130-4. PMC: 344624. DOI: 10.1073/pnas.81.1.130. View

14.

Scheek R, Boelens R, Russo N, VAN Boom J, Kaptein R . Sequential resonance assignments in 1H NMR spectra of oligonucleotides by two-dimensional NMR spectroscopy. Biochemistry. 1984; 23(7):1371-6. DOI: 10.1021/bi00302a006. View

15.

Chou S, Wemmer D, Hare D, Reid B . Sequence-specific recognition of DNA: NMR studies of the imino protons of a synthetic RNA polymerase promoter. Biochemistry. 1984; 23(10):2257-62. DOI: 10.1021/bi00305a026. View

16.

Marion D, Lancelot G . Sequential assignment of the 1H and 31P resonances of the double stranded deoxynucleotide d (ATGCAT)2 by 2D-NMR correlation spectroscopy. Biochem Biophys Res Commun. 1984; 124(3):774-83. DOI: 10.1016/0006-291x(84)91025-8. View

17.

Nussinov R . Large helical conformational deviations from ideal B-DNA and prokaryotic regulatory sites. J Theor Biol. 1985; 115(2):179-89. DOI: 10.1016/s0022-5193(85)80094-1. View

18.

Lefevre J, Lane A, Jardetzky O . A temperature dependent transition in the Pribnow box of the trp promoter. FEBS Lett. 1985; 190(1):37-40. DOI: 10.1016/0014-5793(85)80422-1. View

19.

Lefevre J, Lane A, Jardetzky O . Nuclear magnetic resonance study of the proton exchange rate in the operator-promoter DNA sequence of the trp operon of Escherichia coli. J Mol Biol. 1985; 185(4):689-99. DOI: 10.1016/0022-2836(85)90054-3. View

20.

Nilges M, Clore G, Gronenborn A, Piel N, McLaughlin L . Refinement of the solution structure of the DNA decamer 5'd(CTGGATCCAG)2: combined use of nuclear magnetic resonance and restrained molecular dynamics. Biochemistry. 1987; 26(12):3734-44. DOI: 10.1021/bi00386a069. View