» Articles » PMID: 8449175

Determination of Conformational Transition Rates in the Trp Promoter by 1H NMR Rotating-frame T1 and Cross-relaxation Rate Measurements

Overview
Journal Eur Biophys J
Specialty Biophysics
Date 1993 Jan 1
PMID 8449175
Citations 6
Authors
Affiliations
Soon will be listed here.
Abstract

Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefèvre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s-1 at 30 degrees C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the -35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence.

Citing Articles

Rapid assessment of Watson-Crick to Hoogsteen exchange in unlabeled DNA duplexes using high-power SELOPE imino H CEST.

Liu B, Rangadurai A, Shi H, Al-Hashimi H Magn Reson (Gott). 2023; 2(2):715-731.

PMID: 37905209 PMC: 10539785. DOI: 10.5194/mr-2-715-2021.


Characterizing micro-to-millisecond chemical exchange in nucleic acids using off-resonance R relaxation dispersion.

Rangadurai A, Szymaski E, Kimsey I, Shi H, Al-Hashimi H Prog Nucl Magn Reson Spectrosc. 2019; 112-113:55-102.

PMID: 31481159 PMC: 6727989. DOI: 10.1016/j.pnmrs.2019.05.002.


The influence of DNA binding on the backbone dynamics of the yeast cell-cycle protein Mbp1.

McIntosh P, Taylor I, Frenkiel T, Smerdon S, Lane A J Biomol NMR. 2000; 16(3):183-96.

PMID: 10805125 DOI: 10.1023/a:1008374129366.


The dependence of DNase I activity on the conformation of oligodeoxynucleotides.

Sutton D, Conn G, Brown T, Lane A Biochem J. 1997; 321 ( Pt 2):481-6.

PMID: 9020884 PMC: 1218094. DOI: 10.1042/bj3210481.


Determination of sugar conformations by NMR in larger DNA duplexes using both dipolar and scalar data: application to d(CATGTGACGTCACATG)2.

Conte M, Bauer C, Lane A J Biomol NMR. 1996; 7(3):190-206.

PMID: 8785496 DOI: 10.1007/BF00202036.


References
1.
Lane A . Solution conformation and dynamics of the octadeoxy-nucleotide d(CACTAGTG)2: a multinuclear n.m.r. relaxation study. Carbohydr Res. 1991; 221:123-44. DOI: 10.1016/0008-6215(91)80052-o. View

2.
Leroy J, Charretier E, Kochoyan M, Gueron M . Evidence from base-pair kinetics for two types of adenine tract structures in solution: their relation to DNA curvature. Biochemistry. 1988; 27(25):8894-8. DOI: 10.1021/bi00425a004. View

3.
Kordel J, Skelton N, Akke M, Palmer 3rd A, Chazin W . Backbone dynamics of calcium-loaded calbindin D9k studied by two-dimensional proton-detected 15N NMR spectroscopy. Biochemistry. 1992; 31(20):4856-66. DOI: 10.1021/bi00135a017. View

4.
Kay L, Torchia D, Bax A . Backbone dynamics of proteins as studied by 15N inverse detected heteronuclear NMR spectroscopy: application to staphylococcal nuclease. Biochemistry. 1989; 28(23):8972-9. DOI: 10.1021/bi00449a003. View

5.
Birchall A, Lane A . Anisotropic rotation in nucleic acid fragments: significance for determination of structures from NMR data. Eur Biophys J. 1990; 19(2):73-8. DOI: 10.1007/BF00185089. View