Vitamin D-mediated Modifications in Protein-DNA Interactions at Two Promoter Elements of the Osteocalcin Gene

Overview

Journal Proc Natl Acad Sci U S A

Specialty Science

Date 1990 Mar 1

PMID 2308930

Citations 30

Authors

E R Markose

J L Stein

G S Stein

J B Lian

Affiliations

Soon will be listed here.

Abstract

By the combined use of DNase I footprinting, electrophoretic mobility-shift assay, and methylation interference analysis, we have identified a series of sequence-specific protein-DNA interactions in the 5' flanking region of the rat osteocalcin gene. Stimulation of osteocalcin gene expression by 1,25-dihydroxyvitamin D3, a physiologic mediator of this bone-specific gene in vitro and in vivo, is associated with modifications in the binding of ROS 17/2.8 cell nuclear factors to two promoter segments that up-regulate transcription. One segment located between -462 and -437 exhibits a vitamin D-dependent increase in sequence-specific binding of nuclear factors. This element (CTGGGTGAATGAGGACATTACTGACC), identified at single nucleotide resolution, contains a region of hyphenated dyad symmetry and shares sequence homology with consensus steroid-responsive elements and with the sequence that has been identified as the vitamin D receptor binding site in the human osteocalcin gene. We have also observed that vitamin D stimulation of osteocalcin gene expression results in a 5-fold increase in protein binding to the region of the osteocalcin box, a 24-nucleotide segment in the proximal promoter with a CCAAT motif as the central core. Our results demonstrate protein-DNA interactions in a vitamin D-responsive element and in a second sequence, the osteocalcin box, both of which are involved in the physiologic regulation of the osteocalcin gene in response to 1,25-dihydroxyvitamin D3.

Citing Articles

Bone Turnover in Relation to Thyroid-Stimulating Hormone in Hypothyroid Patients on Thyroid Hormone Substitution Therapy.

Bjerkreim B, Hammerstad S, Eriksen E J Thyroid Res. 2022; 2022:8950546.

PMID: 36248357 PMC: 9553712. DOI: 10.1155/2022/8950546.

Transcriptional Regulation of Cytosolic Sulfotransferase 1C2 by Vitamin D Receptor in LS180 Human Colorectal Adenocarcinoma Cells.

Barrett K, Fang H, Kocarek T, Runge-Morris M Drug Metab Dispos. 2016; 44(8):1431-4.

PMID: 27130351 PMC: 4986619. DOI: 10.1124/dmd.116.070300.

Fibroblast growth factor enhances expression of TGFβ-stimulated-clone-22 gene in osteoblast-like cells.

Kawa-Uchi T, Nose K, Noda M Endocrine. 2010; 3(11):833-7.

PMID: 21153129 DOI: 10.1007/BF02935689.

The nuclear vitamin D receptor controls the expression of genes encoding factors which feed the "Fountain of Youth" to mediate healthful aging.

Haussler M, Haussler C, Whitfield G, Hsieh J, Thompson P, Barthel T J Steroid Biochem Mol Biol. 2010; 121(1-2):88-97.

PMID: 20227497 PMC: 2906618. DOI: 10.1016/j.jsbmb.2010.03.019.

Expression of human kinase suppressor of Ras 2 (hKSR-2) gene in HL60 leukemia cells is directly upregulated by 1,25-dihydroxyvitamin D(3) and is required for optimal cell differentiation.

Wang X, Wang T, White J, Studzinski G Exp Cell Res. 2007; 313(14):3034-45.

PMID: 17599832 PMC: 3351793. DOI: 10.1016/j.yexcr.2007.05.021.

References

Augereau P, Chambon P . The mouse immunoglobulin heavy-chain enhancer: effect on transcription in vitro and binding of proteins present in HeLa and lymphoid B cell extracts. EMBO J. 1986; 5(8):1791-7. PMC: 1167042. DOI: 10.1002/j.1460-2075.1986.tb04428.x. View

Demay M, Gerardi J, DeLuca H, Kronenberg H . DNA sequences in the rat osteocalcin gene that bind the 1,25-dihydroxyvitamin D3 receptor and confer responsiveness to 1,25-dihydroxyvitamin D3. Proc Natl Acad Sci U S A. 1990; 87(1):369-73. PMC: 53265. DOI: 10.1073/pnas.87.1.369. View

Pauli U, Chrysogelos S, Stein G, Stein J, Nick H . Protein-DNA interactions in vivo upstream of a cell cycle-regulated human H4 histone gene. Science. 1987; 236(4806):1308-11. DOI: 10.1126/science.3035717. View

Westin G, Schaffner W . Heavy metal ions in transcription factors from HeLa cells: Sp1, but not octamer transcription factor requires zinc for DNA binding and for activator function. Nucleic Acids Res. 1988; 16(13):5771-81. PMC: 336828. DOI: 10.1093/nar/16.13.5771. View

Yoon K, Rutledge S, Buenaga R, Rodan G . Characterization of the rat osteocalcin gene: stimulation of promoter activity by 1,25-dihydroxyvitamin D3. Biochemistry. 1988; 27(23):8521-6. DOI: 10.1021/bi00423a003. View

Demay M, Roth D, Kronenberg H . Regions of the rat osteocalcin gene which mediate the effect of 1,25-dihydroxyvitamin D3 on gene transcription. J Biol Chem. 1989; 264(4):2279-82. View

Lian J, Stewart C, Puchacz E, Mackowiak S, Shalhoub V, Collart D . Structure of the rat osteocalcin gene and regulation of vitamin D-dependent expression. Proc Natl Acad Sci U S A. 1989; 86(4):1143-7. PMC: 286642. DOI: 10.1073/pnas.86.4.1143. View

Tushinski R, Sussman P, Yu L, Bancroft F . Pregrowth hormone messenger RNA: glucocorticoid induction and identification in rat pituitary cells. Proc Natl Acad Sci U S A. 1977; 74(6):2357-61. PMC: 432170. DOI: 10.1073/pnas.74.6.2357. View

Dignam J, Lebovitz R, Roeder R . Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 1983; 11(5):1475-89. PMC: 325809. DOI: 10.1093/nar/11.5.1475. View

10.

Thomas P . Hybridization of denatured RNA transferred or dotted nitrocellulose paper. Methods Enzymol. 1983; 100:255-66. DOI: 10.1016/0076-6879(83)00060-9. View

11.

Pan L, Price P . The effect of transcriptional inhibitors on the bone gamma-carboxyglutamic acid protein response to 1,25-dihydroxyvitamin D3 in osteosarcoma cells. J Biol Chem. 1984; 259(9):5844-7. View

12.

Pauli U, Chrysogelos S, Nick H, Stein G, Stein J . In vivo protein binding sites and nuclease hypersensitivity in the promoter region of a cell cycle regulated human H3 histone gene. Nucleic Acids Res. 1989; 17(6):2333-50. PMC: 317599. DOI: 10.1093/nar/17.6.2333. View

13.

Theofan G, Haberstroh L, Price P . Molecular structure of the rat bone Gla protein gene and identification of putative regulatory elements. DNA. 1989; 8(3):213-21. DOI: 10.1089/dna.1.1989.8.213. View

14.

Kerner S, Scott R, Pike J . Sequence elements in the human osteocalcin gene confer basal activation and inducible response to hormonal vitamin D3. Proc Natl Acad Sci U S A. 1989; 86(12):4455-9. PMC: 287288. DOI: 10.1073/pnas.86.12.4455. View

15.

Hauschka P, Lian J, Cole D, Gundberg C . Osteocalcin and matrix Gla protein: vitamin K-dependent proteins in bone. Physiol Rev. 1989; 69(3):990-1047. DOI: 10.1152/physrev.1989.69.3.990. View

16.

Minghetti P, Gibbs P, Norman A . Computer analysis of 1,25-dihydroxyvitamin D3-receptor regulated promoters: identification of a candidate D3-response element. Biochem Biophys Res Commun. 1989; 162(2):869-75. DOI: 10.1016/0006-291x(89)92390-5. View

17.

van Wijnen A, Wright K, Lian J, Stein J, Stein G . Human H4 histone gene transcription requires the proliferation-specific nuclear factor HiNF-D. Auxiliary roles for HiNF-C (Sp1-like) and HiNF-A (high mobility group-like). J Biol Chem. 1989; 264(25):15034-42. View

18.

Celeste A, Rosen V, Buecker J, Kriz R, Wang E, Wozney J . Isolation of the human gene for bone gla protein utilizing mouse and rat cDNA clones. EMBO J. 1986; 5(8):1885-90. PMC: 1167054. DOI: 10.1002/j.1460-2075.1986.tb04440.x. View