The Sequence of 5S Ribosomal RNA of the Crustacean Artemia Salina

Overview

Journal Nucleic Acids Res

Publisher Oxford University Press

Specialty Biochemistry

Date 1981 Oct 10

PMID 7312626

Citations 12

Authors

L Diels

R De Baere

A Vandenberghe

R De Wachter

Affiliations

Soon will be listed here.

Abstract

The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU (OH).

Citing Articles

Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

Perina A, Seoane D, Gonzalez-Tizon A, Rodriguez-Farina F, Martinez-Lage A BMC Evol Biol. 2011; 11:304.

PMID: 22004418 PMC: 3215682. DOI: 10.1186/1471-2148-11-304.

Nucleotide sequences of three poriferan 5 S ribosomal RNAs.

Dams E, Vandenberghe A, De Wachter R Nucleic Acids Res. 1982; 10(17):5297-302.

PMID: 7145701 PMC: 320872. DOI: 10.1093/nar/10.17.5297.

Sequences of three molluscan 5 S ribosomal RNAs confirm the validity of a dynamic secondary structure model.

Fang B, De Baere R, Vandenberghe A, De Wachter R Nucleic Acids Res. 1982; 10(15):4679-85.

PMID: 7133995 PMC: 321121. DOI: 10.1093/nar/10.15.4679.

Nucleotide sequences of 5S ribosomal RNA from four oomycete and chytrid water molds.

Walker W, Doolittle W Nucleic Acids Res. 1982; 10(18):5717-21.

PMID: 6890670 PMC: 320919. DOI: 10.1093/nar/10.18.5717.

Collection of published 5S and 5.8S ribosomal RNA sequences.

Erdmann V, Huysmans E, Vandenberghe A, De Wachter R Nucleic Acids Res. 1983; 11(1):r105-33.

PMID: 6866760 PMC: 325704.

References

Stanley J, VASSILENKO S . A different approach to RNA sequencing. Nature. 1978; 274(5666):87-9. DOI: 10.1038/274087a0. View

Benhamou J, Jourdan R, Jordan B . Sequence of Drosophila 5S RNA synthesized by cultured cells and by the insect at different developmental stages. Homogeneity of the product and homologies with other 5S RNA's at the level of primary and secondary structure. J Mol Evol. 1977; 9(3):279-98. DOI: 10.1007/BF01796116. View

Peattie D . Direct chemical method for sequencing RNA. Proc Natl Acad Sci U S A. 1979; 76(4):1760-4. PMC: 383470. DOI: 10.1073/pnas.76.4.1760. View

Pinck L, Pinck M . Sequence homology at the 3'-ends of alfalfa mosaic virus RNAs. FEBS Lett. 1979; 107(1):61-5. DOI: 10.1016/0014-5793(79)80463-9. View

Diels L, De Wachter R . An RNA sequencing method based on a two-dimensional combination of gel electrophoresis and thin-layer chromatography [proceedings]. Arch Int Physiol Biochim. 1980; 88(1):B26-B27. View

Tanaka Y, Dyer T, Brownlee G . An improved direct RNA sequence method; its application to Vicia faba 5.8S ribosomal RNA. Nucleic Acids Res. 1980; 8(6):1259-72. PMC: 323990. DOI: 10.1093/nar/8.6.1259. View

Vandenberghe A, Nelles L, De Wachter R . High-pressure liquid chromatography analysis of oligo- and monoribonucleotide mixtures, with special reference to ribosomal RNA constituents. Anal Biochem. 1980; 107(2):369-76. DOI: 10.1016/0003-2697(80)90398-x. View

Tschudi C, Pirrotta V . Sequence and heterogeneity in the 5S RNA gene cluster of Drosophila melanogaster. Nucleic Acids Res. 1980; 8(3):441-51. PMC: 327282. DOI: 10.1093/nar/8.3.441. View

Hori H, Osawa S, Iwabuchi M . The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum. Nucleic Acids Res. 1980; 8(23):5535-9. PMC: 324323. DOI: 10.1093/nar/8.23.5535. View

10.

Erdmann V . Collection of published 5S and 5.8S RNA sequences and their precursors. Nucleic Acids Res. 1981; 9(1):r25-42. PMC: 326681. DOI: 10.1093/nar/9.1.213-a. View

11.

Kuntzel H, Heidrich M, Piechulla B . Phylogenetic tree derived from bacterial, cytosol and organelle 5S rRNA sequences. Nucleic Acids Res. 1981; 9(6):1451-61. PMC: 326769. DOI: 10.1093/nar/9.6.1451. View

12.

Luehrsen K, Fox G . Secondary structure of eukaryotic cytoplasmic 5S ribosomal RNA. Proc Natl Acad Sci U S A. 1981; 78(4):2150-4. PMC: 319301. DOI: 10.1073/pnas.78.4.2150. View

13.

Komiya H, Kawakami M, Shimizu N, Takemura S . Nucleotide sequences and evolutional aspect of 5S ribosomal RNAs from Lingula and silkworm. Nucleic Acids Symp Ser. 1980; (8):s119-22. View

14.

Zasloff M, Ochoa S . A supernatant factor involved in initiation complex formation with eukaryotic ribosomes. Proc Natl Acad Sci U S A. 1971; 68(12):3059-63. PMC: 389590. DOI: 10.1073/pnas.68.12.3059. View

15.

Fox G, Woese C . 5S RNA secondary structure. Nature. 1975; 256(5517):505-7. DOI: 10.1038/256505a0. View

16.

Benhamou J, Jordan B . Nucleotide sequence of Drosophila melanogaster 5S RNA: evidence for a general 5S RNA model. FEBS Lett. 1976; 62(2):146-9. DOI: 10.1016/0014-5793(76)80039-7. View

17.

Hori H, Osawa S . Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species. Proc Natl Acad Sci U S A. 1979; 76(1):381-5. PMC: 382943. DOI: 10.1073/pnas.76.1.381. View