Characterization of an Avian Infectious Bronchitis Virus Isolated in China from Chickens with Nephritis

Overview

Journal J Vet Med B Infect Dis Vet Public Health

Specialty Veterinary Medicine

Date 2004 Jul 2

PMID 15228547

Citations 9

Authors

J-Y Zhou

D-Y Zhang

J-X Ye

L-Q Cheng

Affiliations

Soon will be listed here.

Abstract

One IBV isolate, SC021202, was isolated from the kidneys of the infected young chickens by inoculating embryonated eggs, and its morphology, physiochemical and haemagglutonating properties were detected. Virulence of the isolate SC021202 was determined with specific pathogen-free (SPF) chicken inoculation. Nucleotide acid sequence of S1 gene of the isolate SC021202 was further sequenced and analysed. The physiochemical and morphological properties of the isolate SC021202 were in accordance to that of typical infectious bronchitis virus (IBV). In a pathogenicity experiment, the clinical signs and related gross lesions resembling those of field outbreak were reproduced and the virus isolate SC021202 was re-isolated from the kidneys of the infected chicken. Sequence data demonstrated that the full length of the amplified S1 gene of the isolate SC021202 was composed of 1931 nucleotides, coding a polypeptide of 543 amino acid residues. Compared with IBV strains from GenBank, the nucleotide and deduced amino acid sequence of S1 gene of the isolate SC021202 shared 60.0-91.4% and 49.1-88.9% identities, respectively. A nucleotide fragment of 'CTTTTTAATTATACTAACGGA' was inserted at nucleotide site 208 in the S1 gene of the isolate. These results indicated that IBV isolate SC021202 was a new variant IBV isolate and responsible for field outbreak of nephritis.

Citing Articles

Detection and Molecular Characterization of Enteric Viruses in Poultry Flocks in Hebei Province, China.

Chen L, Chen L, Wang X, Huo S, Li Y Animals (Basel). 2022; 12(20).

PMID: 36290263 PMC: 9598388. DOI: 10.3390/ani12202873.

Development and application of nsp5-ELISA for the detection of antibody to infectious bronchitis virus.

Lei J, Shi T, Sun D, Mo K, Yan Y, Jin Y J Virol Methods. 2017; 243:182-189.

PMID: 28223026 PMC: 7113779. DOI: 10.1016/j.jviromet.2017.01.026.

Isolation of a novel serotype strain of infectious bronchitis virus ZZ2004 from ducks in China.

Yao S, Ou C, Liu X, Wang X, Yao Z, Liu J Virus Genes. 2016; 52(5):660-70.

PMID: 27164844 PMC: 7089278. DOI: 10.1007/s11262-016-1352-8.

Complete genome sequence of a nephropathogenic infectious bronchitis virus strain isolated in china.

Yang J, Ma B Genome Announc. 2013; 1(5).

PMID: 24115543 PMC: 3795213. DOI: 10.1128/genomeA.00815-13.

Avian infectious bronchitis and deep pectoral myopathy - a case control study.

Almeida D, Tortelly R, Nascimento E, Chagas M, Khan M, Pereira V Poult Sci. 2012; 91(12):3052-6.

PMID: 23155012 PMC: 7194598. DOI: 10.3382/ps.2012-02476.

References

Kusters J, Niesters H, Bleumink-Pluym N, Davelaar F, Horzinek M, van der Zeijst B . Molecular epidemiology of infectious bronchitis virus in The Netherlands. J Gen Virol. 1987; 68 ( Pt 2):343-52. DOI: 10.1099/0022-1317-68-2-343. View

Kwon H, Jackwood M . Molecular cloning and sequence comparison of the S1 glycoprotein of the Gray and JMK strains of avian infectious bronchitis virus. Virus Genes. 1995; 9(3):219-29. PMC: 7089256. DOI: 10.1007/BF01702878. View

Cavanagh D, Davis P, Mockett A . Amino acids within hypervariable region 1 of avian coronavirus IBV (Massachusetts serotype) spike glycoprotein are associated with neutralization epitopes. Virus Res. 1988; 11(2):141-50. PMC: 7134048. DOI: 10.1016/0168-1702(88)90039-1. View

Li H, Yang H . Sequence analysis of nephropathogenic infectious bronchitis virus strains of the Massachusetts genotype in Beijing. Avian Pathol. 2009; 30(5):535-41. DOI: 10.1080/03079450120078734. View

Koch G, Hartog L, Kant A, van Roozelaar D . Antigenic domains on the peplomer protein of avian infectious bronchitis virus: correlation with biological functions. J Gen Virol. 1990; 71 ( Pt 9):1929-35. DOI: 10.1099/0022-1317-71-9-1929. View

Albassam M, WINTERFIELD R, Thacker H . Comparison of the nephropathogenicity of four strains of infectious bronchitis virus. Avian Dis. 1986; 30(3):468-76. View

Wang L, Junker D, Hock L, Ebiary E, Collisson E . Evolutionary implications of genetic variations in the S1 gene of infectious bronchitis virus. Virus Res. 1994; 34(3):327-38. PMC: 7134089. DOI: 10.1016/0168-1702(94)90132-5. View

Parsons D, Ellis M, Cavanagh D, Cook J . Characterisation of an infectious bronchitis virus isolated from vaccinated broiler breeder flocks. Vet Rec. 1992; 131(18):408-11. DOI: 10.1136/vr.131.18.408. View

Chandra M . Comparative nephropathogenicity of different strains of infectious bronchitis virus in chickens. Poult Sci. 1987; 66(6):954-9. DOI: 10.3382/ps.0660954. View

10.

Stern D, Kennedy S . Coronavirus multiplication strategy. I. Identification and characterization of virus-specified RNA. J Virol. 1980; 34(3):665-74. PMC: 288755. DOI: 10.1128/JVI.34.3.665-674.1980. View

11.

Cavanagh D, Davis P, Pappin D, Binns M, Boursnell M, Brown T . Coronavirus IBV: partial amino terminal sequencing of spike polypeptide S2 identifies the sequence Arg-Arg-Phe-Arg-Arg at the cleavage site of the spike precursor propolypeptide of IBV strains Beaudette and M41. Virus Res. 1986; 4(2):133-43. PMC: 7133853. DOI: 10.1016/0168-1702(86)90037-7. View

12.

Wang C, Huang Y . Relationship between serotypes and genotypes based on the hypervariable region of the S1 gene of infectious bronchitis virus. Arch Virol. 2001; 145(2):291-300. PMC: 7086635. DOI: 10.1007/s007050050024. View

13.

Gelb Jr J, Keeler Jr C, Nix W, Rosenberger J, Cloud S . Antigenic and S-1 genomic characterization of the Delaware variant serotype of infectious bronchitis virus. Avian Dis. 1997; 41(3):661-9. View

14.

Fulton R, Reed W, Thacker H . Cellular response of the respiratory tract of chickens to infection with Massachusetts 41 and Australian T infectious bronchitis viruses. Avian Dis. 1993; 37(4):951-60. View

15.

WINTERFIELD R, Albassam M . Nephropathogenicity of infectious bronchitis virus. Poult Sci. 1984; 63(12):2358-63. DOI: 10.3382/ps.0632358. View

16.

Sapats S, Ashton F, Wright P, Ignjatovic J . Sequence analysis of the S1 glycoprotein of infectious bronchitis viruses: identification of a novel genotypic group in Australia. J Gen Virol. 1996; 77 ( Pt 3):413-8. DOI: 10.1099/0022-1317-77-3-413. View

17.

Cavanagh D, Davis P . Evolution of avian coronavirus IBV: sequence of the matrix glycoprotein gene and intergenic region of several serotypes. J Gen Virol. 1988; 69 ( Pt 3):621-9. DOI: 10.1099/0022-1317-69-3-621. View

18.

Zhou J, Wu J, Cheng L, Zheng X, Gong H, Shang S . Expression of immunogenic S1 glycoprotein of infectious bronchitis virus in transgenic potatoes. J Virol. 2003; 77(16):9090-3. PMC: 167223. DOI: 10.1128/jvi.77.16.9090-9093.2003. View

19.

Alexander D, Chettle N . Procedures for the haemagglutination and the haemagglutination inhibition tests for avian infectious bronchitis virus. Avian Pathol. 1977; 6(1):9-17. DOI: 10.1080/03079457708418208. View

20.

El-Houadfi M, Jones R, Cook J, Ambali A . The isolation and characterisation of six avian infectious bronchitis viruses isolated in Morocco. Avian Pathol. 1986; 15(1):93-105. DOI: 10.1080/03079458608436269. View