The Nucleotide Sequence of 5S RRNA from a Red Alga, Porphyra Yezoensis

Overview

Journal Nucleic Acids Res

Publisher Oxford University Press

Specialty Biochemistry

Date 1982 Oct 11

PMID 7145715

Citations 8

Authors

F Takaiwa

M Kusuda

N Saga

M Sugiura

Affiliations

Soon will be listed here.

Abstract

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

Citing Articles

Isotopic relationships between saponifiable lipids and cellulose nitrate prepared from red, brown and green algae.

Sternberg L, De Niro M, Ajie H Planta. 2013; 169(3):320-4.

PMID: 24232642 DOI: 10.1007/BF00392126.

The nucleotide sequences of 5S rRNAs from two red algae, Gracilaria compressa and Porphyra tenera.

Lim B, Hori H, Osawa S Nucleic Acids Res. 1983; 11(15):5185-8.

PMID: 6878042 PMC: 326247. DOI: 10.1093/nar/11.15.5185.

Collection of published 5S and 5.8S ribosomal RNA sequences.

Erdmann V, Huysmans E, Vandenberghe A, De Wachter R Nucleic Acids Res. 1983; 11(1):r105-33.

PMID: 6866760 PMC: 325704.

The nucleotide sequences of 5S rRNAs from a multicellular green alga, Ulva pertusa, and two brown algae, Eisenia bicyclis and Sargassum fulvellum.

Lim B, Hori H, Osawa S Nucleic Acids Res. 1983; 11(6):1909-12.

PMID: 6835842 PMC: 325844. DOI: 10.1093/nar/11.6.1909.

Collection of published 5S and 5.8S ribosomal RNA sequences.

Erdmann V, Wolters J, Huysmans E, Vandenberghe A, De Wachter R Nucleic Acids Res. 1984; 12 Suppl:r133-66.

PMID: 6728686 PMC: 320007. DOI: 10.1093/nar/12.suppl.r133.

References

Sugiura M, TAKANAMI M . Analysis of the 5'-terminal nucleotide sequences of ribonucleic acids. II. Comparison of the 5'-terminal nucleotide sequences of ribosomal RNA's from different organisms. Proc Natl Acad Sci U S A. 1967; 58(4):1595-602. PMC: 223966. DOI: 10.1073/pnas.58.4.1595. View

Kimura M, Ohta T . Eukaryotes-prokaryotes divergence estimated by 5S ribosomal RNA sequences. Nat New Biol. 1973; 243(128):199-200. DOI: 10.1038/newbio243199a0. View

Sugiura M, Suzuki M, Ohtsuka E, Nishikawa S, Uemura H, Ikehara M . Purification of T4 RNA ligase by 2', 5'-ADP sepharose chromatography. FEBS Lett. 1979; 97(1):73-6. DOI: 10.1016/0014-5793(79)80055-1. View

Hori H, Osawa S . Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species. Proc Natl Acad Sci U S A. 1979; 76(1):381-5. PMC: 382943. DOI: 10.1073/pnas.76.1.381. View

Takaiwa F, Sugiura M . Cloning and characterization of 4.5S and 5S RNA genes in tobacco chloroplasts. Gene. 1980; 10(2):95-103. DOI: 10.1016/0378-1119(80)90127-4. View