Alpha 2.0
Login Register
» Articles » PMID: 38062488

Two Novel Deletion Mutations in β-globin Gene Cause β-thalassemia Trait in Two Chinese Families

Overview
Journal Hum Genomics
Publisher Biomed Central
Specialty Genetics
Date 2023 Dec 8
PMID 38062488
Authors
Xiuqin Bao
Danqing Qin
Jicheng Wang
Jing Chen
Cuize Yao
Jie Liang
Kailing Liang
Yixia Wang
Yousheng Wang
Li Du
Aihua Yin
Affiliations
Soon will be listed here.
Abstract

Background: β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered.

Results: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed β) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed β) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major.

Conclusion: Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

References
1.
Yin A, Li B, Luo M, Xu L, Wu L, Zhang L . The prevalence and molecular spectrum of α- and β-globin gene mutations in 14,332 families of Guangdong Province, China. PLoS One. 2014; 9(2):e89855. PMC: 3937408. DOI: 10.1371/journal.pone.0089855. View
2.
Bao X, Wang J, Qin D, Yao C, Liang J, Liang K . Identification of four novel large deletions and complex variants in the α-globin locus in Chinese population. Hum Genomics. 2023; 17(1):38. PMC: 10127377. DOI: 10.1186/s40246-023-00486-4. View
3.
Origa R . β-Thalassemia. Genet Med. 2016; 19(6):609-619. DOI: 10.1038/gim.2016.173. View
4.
Chen D, Zuo Y, Zhang X, Ye Y, Bao X, Huang H . A Genetic Variant Ameliorates β-Thalassemia Severity by Epigenetic-Mediated Elevation of Human Fetal Hemoglobin Expression. Am J Hum Genet. 2017; 101(1):130-138. PMC: 5501772. DOI: 10.1016/j.ajhg.2017.05.012. View
5.
Martyn G, Wienert B, Yang L, Shah M, Norton L, Burdach J . Natural regulatory mutations elevate the fetal globin gene via disruption of BCL11A or ZBTB7A binding. Nat Genet. 2018; 50(4):498-503. DOI: 10.1038/s41588-018-0085-0. View