A Heterozygous Duplication Variant of the HOXD13 Gene Caused Synpolydactyly Type 1 with Variable Expressivity in a Chinese Family

Overview

Journal BMC Med Genet

Publisher Biomed Central

Specialty Genetics

Date 2019 Dec 25

PMID 31870337

Citations 7

Authors

Tahir Zaib

Wei Ji

Komal Saleem

Guangchen Nie

Chao Li

Lin Cao

Baijun Xu

Kexian Dong

Hanfei Yu

Xuguang Hao

Yan Xue

Shuhan Si

Xueyuan Jia

Jie Wu

Xuelong Zhang

Rongwei Guan

Guohua Ji

Jing Bai

Feng Chen

Yong Liu

Wenjing Sun

Songbin Fu

Affiliations

Soon will be listed here.

Abstract

Background: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family.

Methods: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines.

Results: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family.

Conclusion: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Citing Articles

New insight into the development of synpolydactyly caused by expansion of HOXD13 polyalanine based on weighted gene co-expression network analysis.

Chen X, Shen X, Yang T, Cao Y, Zhao X BMC Med Genomics. 2024; 17(1):259.

PMID: 39472920 PMC: 11523653. DOI: 10.1186/s12920-024-01974-9.

Whole-Genome Sequencing for Identifying Candidate Genes Related to the Special Phenotypes of the Taihu Dianzi Pigeon.

Zhang R, Mu C, Chang L, Shen X, Bu Z, Yang M Animals (Basel). 2024; 14(7).

PMID: 38612286 PMC: 11011069. DOI: 10.3390/ani14071047.

Clinical and genetic analysis in Chinese families with synpolydactyly, and cellular localization of HOXD13 with different length of polyalanine tract.

Chen X, Zhao F, Xu Y, Cao Y, Li S, Zhang X Front Genet. 2023; 14:1105046.

PMID: 37035736 PMC: 10073534. DOI: 10.3389/fgene.2023.1105046.

Epidemiological Characteristics and Role of Connexin-43 in Patients of Syndactyly Attending a Tertiary Care Center in Odisha, India.

Sahoo S, Banik S, Giri S, Tripathy P, Kumar K Cureus. 2022; 14(10):e30327.

PMID: 36407278 PMC: 9662593. DOI: 10.7759/cureus.30327.

Identification of a HOXD13 variant in a Mongolian family with incomplete penetrance syndactyly by exon sequencing.

Husile H, Wu Z, Yang L, Cao Y, Wu Q BMC Med Genomics. 2022; 15(1):210.

PMID: 36195906 PMC: 9533607. DOI: 10.1186/s12920-022-01360-3.

References

Dai L, Liu D, Song M, Xu X, Xiong G, Yang K . Mutations in the homeodomain of HOXD13 cause syndactyly type 1-c in two Chinese families. PLoS One. 2014; 9(5):e96192. PMC: 4006867. DOI: 10.1371/journal.pone.0096192. View

Gong L, Wang B, Wang J, Yu H, Ma X, Yang J . Polyalanine repeat expansion mutation of the HOXD13 gene in a Chinese family with unusual clinical manifestations of synpolydactyly. Eur J Med Genet. 2010; 54(2):108-11. DOI: 10.1016/j.ejmg.2010.10.007. View

Li H, Durbin R . Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009; 25(14):1754-60. PMC: 2705234. DOI: 10.1093/bioinformatics/btp324. View

Horsnell K, Ali M, Malik S, Wilson L, Hall C, Debeer P . Clinical phenotype associated with homozygosity for a HOXD13 7-residue polyalanine tract expansion. Eur J Med Genet. 2006; 49(5):396-401. DOI: 10.1016/j.ejmg.2006.01.004. View

Jin H, Lin P, Wang Q, Mao F, Cai Y, Gong Y . [Synpolydactyly in a Chinese kindred: mutation detection, prenatal ultrasonographic and molecular diagnosis]. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2011; 28(6):601-5. DOI: 10.3760/cma.j.issn.1003-9406.2011.06.001. View

Wajid M, Ishii Y, Kurban M, Dua-Awereh M, Shimomura Y, Christiano A . Polyalanine repeat expansion mutations in the HOXD13 gene in Pakistani families with synpolydactyly. Clin Genet. 2009; 76(3):300-2. DOI: 10.1111/j.1399-0004.2009.01213.x. View

Akarsu A, Stoilov I, Yilmaz E, Sayli B, Sarfarazi M . Genomic structure of HOXD13 gene: a nine polyalanine duplication causes synpolydactyly in two unrelated families. Hum Mol Genet. 1996; 5(7):945-52. DOI: 10.1093/hmg/5.7.945. View

Xin Q, Li L, Li J, Qiu R, Guo C, Gong Y . Eight-alanine duplication in homeobox D13 in a Chinese family with synpolydactyly. Gene. 2012; 499(1):48-51. DOI: 10.1016/j.gene.2012.02.046. View

Cummings C, Zoghbi H . Fourteen and counting: unraveling trinucleotide repeat diseases. Hum Mol Genet. 2000; 9(6):909-16. DOI: 10.1093/hmg/9.6.909. View

10.

Brison N, Debeer P, Fantini S, Oley C, Zappavigna V, Luyten F . An N-terminal G11A mutation in HOXD13 causes synpolydactyly and interferes with Gli3R function during limb pre-patterning. Hum Mol Genet. 2012; 21(11):2464-75. DOI: 10.1093/hmg/dds060. View

11.

Goodman F, Giovannucci-Uzielli M, Hall C, Reardon W, Winter R, Scambler P . Deletions in HOXD13 segregate with an identical, novel foot malformation in two unrelated families. Am J Hum Genet. 1998; 63(4):992-1000. PMC: 1377502. DOI: 10.1086/302070. View

12.

Ranum L, Day J . Dominantly inherited, non-coding microsatellite expansion disorders. Curr Opin Genet Dev. 2002; 12(3):266-71. DOI: 10.1016/s0959-437x(02)00297-6. View

13.

Li Y, Xin Q, Shan S, Li J, Liu Q . [Mutation analysis of HOXD13 gene in a Chinese family affected with autosomal dominant synpolydactyly]. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2015; 32(4):481-4. DOI: 10.3760/cma.j.issn.1003-9406.2015.04.006. View

14.

Radhakrishnan P, Nayak S, Pai M, Shukla A, Girisha K . Occurrence of Synpolydactyly and Omphalocele in a Fetus with a Mutation. J Pediatr Genet. 2017; 6(3):194-197. PMC: 5548533. DOI: 10.1055/s-0037-1602142. View

15.

Zakany J, Duboule D . Synpolydactyly in mice with a targeted deficiency in the HoxD complex. Nature. 1996; 384(6604):69-71. DOI: 10.1038/384069a0. View

16.

Nakano K, Sakai N, Yamazaki Y, Watanabe H, Yamada N, Sezaki K . Novel mutations of the HOXD13 gene in hand and foot malformations. Int Surg. 2008; 92(5):287-95. View

17.

Low K, Nwbury-Ecob R . Homozygous nonsense mutation in HOXD13 underlies synpolydactyly with a cleft. Clin Dysmorphol. 2012; 21(3):141-143. DOI: 10.1097/MCD.0b013e32835306f0. View

18.

Wang B, Li N, Geng J, Wang Z, Fu Q, Wang J . Exome sequencing identifies a novel nonsense mutation of HOXD13 in a Chinese family with synpolydactyly. Congenit Anom (Kyoto). 2016; 57(1):4-7. DOI: 10.1111/cga.12173. View

19.

Debeer P, Bacchelli C, Scambler P, De Smet L, Fryns J, Goodman F . Severe digital abnormalities in a patient heterozygous for both a novel missense mutation in HOXD13 and a polyalanine tract expansion in HOXA13. J Med Genet. 2002; 39(11):852-6. PMC: 1735011. DOI: 10.1136/jmg.39.11.852. View

20.

Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J . Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015; 17(5):405-24. PMC: 4544753. DOI: 10.1038/gim.2015.30. View