Activation of the Major Immediate Early Gene of Human Cytomegalovirus by Cis-acting Elements in the Promoter-regulatory Sequence and by Virus-specific Trans-acting Components

Overview

Journal J Virol

Publisher American Society for Microbiology

Date 1985 Aug 1

PMID 2991567

Citations 132

Authors

M F Stinski

T J Roehr

Affiliations

Soon will be listed here.

Abstract

Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene.

Citing Articles

pUdOs: Concise Plasmids for Bacterial and Mammalian Cells.

Manigat F, Connell L, Stewart B, LePabic A, Tessier C, Emlaw J ACS Synth Biol. 2024; 13(2):485-497.

PMID: 38235654 PMC: 10878396. DOI: 10.1021/acssynbio.3c00408.

Chromatin control of human cytomegalovirus infection.

Matthews S, Groves I, OConnor C mBio. 2023; 14(4):e0032623.

PMID: 37439556 PMC: 10470543. DOI: 10.1128/mbio.00326-23.

Regulation of the MIE Locus During HCMV Latency and Reactivation.

Dooley A, OConnor C Pathogens. 2020; 9(11).

PMID: 33113934 PMC: 7690695. DOI: 10.3390/pathogens9110869.

The Role of the Human Cytomegalovirus Gene Locus in Latency and Reactivation.

Mlera L, Moy M, Maness K, Tran L, Goodrum F Viruses. 2020; 12(7).

PMID: 32630219 PMC: 7411667. DOI: 10.3390/v12070714.

Alternative promoters drive human cytomegalovirus reactivation from latency.

Collins-McMillen D, Rak M, Buehler J, Igarashi-Hayes S, Kamil J, Moorman N Proc Natl Acad Sci U S A. 2019; 116(35):17492-17497.

PMID: 31409717 PMC: 6717278. DOI: 10.1073/pnas.1900783116.

References

Stinski M . Sequence of protein synthesis in cells infected by human cytomegalovirus: early and late virus-induced polypeptides. J Virol. 1978; 26(3):686-701. PMC: 525893. DOI: 10.1128/JVI.26.3.686-701.1978. View

HORODNICEANU F, GUILLON J . Immediate early antigens in human cytomegalovirus infected cells. Nature. 1977; 270(5638):615-7. DOI: 10.1038/270615a0. View

Campione-Piccardo J, Rawls W, Bacchetti S . Selective assay for herpes simplex viruses expressing thymidine kinase. J Virol. 1979; 31(2):281-7. PMC: 353450. DOI: 10.1128/JVI.31.2.281-287.1979. View

Benoist C, OHare K, Breathnach R, Chambon P . The ovalbumin gene-sequence of putative control regions. Nucleic Acids Res. 1980; 8(1):127-42. PMC: 327247. DOI: 10.1093/nar/8.1.127. View

Maxam A, Gilbert W . Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 1980; 65(1):499-560. DOI: 10.1016/s0076-6879(80)65059-9. View

Manley J, Fire A, Cano A, Sharp P, Gefter M . DNA-dependent transcription of adenovirus genes in a soluble whole-cell extract. Proc Natl Acad Sci U S A. 1980; 77(7):3855-9. PMC: 349725. DOI: 10.1073/pnas.77.7.3855. View

McKnight S . The nucleotide sequence and transcript map of the herpes simplex virus thymidine kinase gene. Nucleic Acids Res. 1980; 8(24):5949-64. PMC: 328064. DOI: 10.1093/nar/8.24.5949. View

Wagner M, Sharp J, Summers W . Nucleotide sequence of the thymidine kinase gene of herpes simplex virus type 1. Proc Natl Acad Sci U S A. 1981; 78(3):1441-5. PMC: 319146. DOI: 10.1073/pnas.78.3.1441. View

Post L, Mackem S, Roizman B . Regulation of alpha genes of herpes simplex virus: expression of chimeric genes produced by fusion of thymidine kinase with alpha gene promoters. Cell. 1981; 24(2):555-65. DOI: 10.1016/0092-8674(81)90346-9. View

10.

Wathen M, Thomsen D, Stinski M . Temporal regulation of human cytomegalovirus transcription at immediate early and early times after infection. J Virol. 1981; 38(2):446-59. PMC: 171176. DOI: 10.1128/JVI.38.2.446-459.1981. View

11.

Blanton R, Tevethia M . Immunoprecipitation of virus-specific immediate-early and early polypeptides from cells lytically infected with human cytomegalovirus strain AD 169. Virology. 1981; 112(1):262-73. DOI: 10.1016/0042-6822(81)90631-0. View

12.

Gibson W . Immediate-early proteins of human cytomegalovirus strains AD 169, Davis, and Towne differ in electrophoretic mobility. Virology. 1981; 112(1):350-4. DOI: 10.1016/0042-6822(81)90641-3. View

13.

DeMarchi J . Human cytomegalovirus DNA: restriction enzyme cleavage maps and map locations for immediate-early, early, and late RNAs. Virology. 1981; 114(1):23-38. DOI: 10.1016/0042-6822(81)90249-x. View

14.

OSullivan M, Marks V . Methods for the preparation of enzyme-antibody conjugates for use in enzyme immunoassay. Methods Enzymol. 1981; 73(Pt B):147-66. DOI: 10.1016/0076-6879(81)73062-3. View

15.

Woo S, BEATTIE W, Catterall J, Dugaiczyk A, Staden R, Brownlee G . Complete nucleotide sequence of the chicken chromosomal ovalbumin gene and its biological significance. Biochemistry. 1981; 20(22):6437-46. DOI: 10.1021/bi00525a024. View

16.

Moreau P, Hen R, Wasylyk B, Everett R, Gaub M, Chambon P . The SV40 72 base repair repeat has a striking effect on gene expression both in SV40 and other chimeric recombinants. Nucleic Acids Res. 1981; 9(22):6047-68. PMC: 327583. DOI: 10.1093/nar/9.22.6047. View

17.

Wathen M, Stinski M . Temporal patterns of human cytomegalovirus transcription: mapping the viral RNAs synthesized at immediate early, early, and late times after infection. J Virol. 1982; 41(2):462-77. PMC: 256775. DOI: 10.1128/JVI.41.2.462-477.1982. View

18.

Thomsen D, Stinski M . Cloning of the human cytomegalovirus genome as endonuclease XbaI fragments. Gene. 1981; 16(1-3):207-16. DOI: 10.1016/0378-1119(81)90077-9. View

19.

Post L, Norrild B, Simpson T, Roizman B . Chicken ovalbumin gene fused to a herpes simplex virus alpha promoter and linked to a thymidine kinase gene is regulated like a viral gene. Mol Cell Biol. 1982; 2(3):233-40. PMC: 369781. DOI: 10.1128/mcb.2.3.233-240.1982. View

20.

Mackem S, Roizman B . Differentiation between alpha promoter and regulator regions of herpes simplex virus 1: the functional domains and sequence of a movable alpha regulator. Proc Natl Acad Sci U S A. 1982; 79(16):4917-21. PMC: 346796. DOI: 10.1073/pnas.79.16.4917. View