Hypoxia-activated Cytochrome Bd Expression in Mycobacterium Smegmatis is Cyclic AMP Receptor Protein Dependent
Overview
Affiliations
Mycobacteria are obligate aerobes and respire using two terminal respiratory oxidases, an aa3-type cytochrome c oxidase and a cytochrome bd-type menaquinol oxidase. Cytochrome bd is encoded by cydAB from the cydABDC gene cluster that is conserved throughout the mycobacterial genus. Here we report that cydAB and cydDC in Mycobacterium smegmatis constitute two separate operons under hypoxic growth conditions. The transcriptional start sites of both operons were mapped, and a series of cydA-lacZ and cydD-lacZ transcriptional reporter fusions were made to identify regulatory promoter elements. A 51-bp region was identified in the cydAB promoter that was required for maximal cydA-lacZ expression in response to hypoxia. A cyclic AMP receptor protein (CRP)-binding site (viz. GTGAN6CCACC) was identified in this region, and mutation of this site to CCCAN6CTTTC abolished cydA-lacZ expression in response to hypoxia. Binding of purified CRP (MSMEG_0539) to the cydAB promoter DNA was analyzed using electrophoretic mobility shift assays. CRP binding was dependent on GTGAN6CCACC and showed cyclic AMP (cAMP) dependency. No CRP site was present in the cydDC promoter, and a 10-bp inverted repeat (CGGTGGTACCGGTACCACCG) was required for maximal cydD-lacZ expression. Taken together, the data indicate that CRP is a direct regulator of cydAB expression in response to hypoxia and that the regulation of cydDC expression is CRP independent and under the control of an unknown regulator.
Identification of genes associated with persistence in .
Joshi H, Kandari D, Maitra S, Bhatnagar R, Banerjee N Front Microbiol. 2024; 15:1302883.
PMID: 38410395 PMC: 10894938. DOI: 10.3389/fmicb.2024.1302883.
Oh Y, Lee H, Ko E, Jeong J, Park S, Oh J J Microbiol. 2023; 61(3):297-315.
PMID: 36847970 DOI: 10.1007/s12275-023-00026-8.
Hopfner S, Lee B, Kalia N, Miller M, Pethe K, Moraski G Appl Sci (Basel). 2023; 11(19).
PMID: 36698770 PMC: 9873234. DOI: 10.3390/app11199092.
Mehdiratta K, Nain S, Sharma M, Singh S, Srivastava S, Dhamale B Microbiol Spectr. 2022; 11(1):e0259722.
PMID: 36507669 PMC: 9927152. DOI: 10.1128/spectrum.02597-22.
Ko E, Oh Y, Oh J J Microbiol. 2022; 60(12):1139-1152.
PMID: 36279104 DOI: 10.1007/s12275-022-2347-x.